Magnetic resonance imaging (MRI) was performed in 30 patients with first-episode schizophrenia – all treated with atypical neuroleptics – and 21 healthy controls. NSS were rated on the Heidelberg Scale. By manual tracing, the cerebellum was divided into the following subregions bilaterally: anterior lobe, superior posterior lobe, inferior posterior lobe, and Blasticidin S corpus medullare,

respectively. Volumetric measures were compared between the two groups and related to NSS scores. NSS scores were significantly higher in patients than in controls. Cerebella of patients were significantly smaller with atrophy pronounced in the corpus medullare bilaterally. In the patients’ group, higher NSS scores were found to be related to reduced volumes of the posterior lobes of the cerebellum. In contrast, no significant associations between NSS scores and cerebellar subregions in healthy subjects arose. Our findings support the hypothesis of cerebellar involvement in schizophrenia and indicate that alterations in distinct cerebellar regions are related to NSS. (C) 2008 Elsevier Ireland Ltd. All rights reserved.”
“A significant problem in the study of Pavlovian conditioning is characterizing the nature of the representations of events that enter into learning. This

issue has been explored extensively with regard to the question of what features of the unconditioned stimulus enter into learning, but considerably Combretastatin A4 mouse less work has been directed to the question Sclareol of characterizing the nature of the conditioned stimulus. This article introduces a multilayered connectionist network approach to understanding how “”perceptual”" or “”conceptual”" representations of the conditioned stimulus might emerge from conditioning and participate in various learning phenomena. The

model is applied to acquired equivalence/distinctiveness of cue effects, as well as a variety of conditional discrimination learning tasks (patterning, biconditional, ambiguous occasion setting, feature discriminations). In addition, studies that have examined what aspects of the unconditioned stimulus enter into learning are also reviewed. Ultimately, it is concluded that adopting a multilayered connectionist network perspective of Pavlovian learning provides us with a richer way in which to view basic learning processes, but a number of key theoretical problems remain to be solved, particularly as they relate to the integration of what we know about the nature of the representations of conditioned and unconditioned stimuli.”
“Studies have demonstrated that AMPHs produce long-term damage to the brain dopaminergic, serotoninergic and glutamatergic regions. Prefrontal cortex, amygdala, hippocampus and striatum appear to be involved in the toxicity and behavioral changes induced by AMPHs. A single dose of AMPH causes mitochondrial dysfunction and oxidative stress in rat brain.

From our results, we propose a model in which the joint MK-2206 price action of chemokines and cytotoxic factors in cytotoxic T-cells, macrophages and myeloid dendritic cells invading the myofiber, ultimately leads to its demise. The processes described seem to be universal to PM and IBM alike. Our observations further consolidate the important autoimmune

component of IBM, a feature still under debate within the scientific community. (C) 2013 ElSevier Ireland Ltd. All rights reserved.”
“CK2 is a multitask kinase whose role is essential for a countless number of cellular processes, many of which are critical for blood cell development. A prevailing Thiazovivin molecular weight task for this kinase rests on counteracting programmed cell death triggered by multiple stimuli. CK2 is overexpressed in many solid tumors and in vivo mouse models have proven its tumorigenic potential. Recent data have suggested that CK2 may also have a significant role

in the pathogenesis of hematopoietic tumors, such as multiple myeloma, chronic lymphocytic leukemia, acute myelogenous leukemia, acute lymphoblastic leukemia and chronic myeloproliferative neoplasms. CK2 regulates hematopoiesis-associated signaling pathways and seems to reinforce biochemical cascades indispensable for tumor growth, proliferation and resistance to conventional and novel cytotoxic agents. Although its activity is multifold, recent evidence supports the rationale of CK2 inhibition as a therapeutic strategy in solid and hematological tumors and phase-I clinical trials are in progress to test the efficacy of this innovative therapeutic approach. In this review, we will summarize the data supporting CK2 as an oncogenic kinase in blood tumors and we will describe some critical signaling pathways, whose regulation Rutecarpine by this protein kinase may be implicated in

tumorigenesis.”
“All-trans-retinoic-acid (ATRA)-induced differentiation of human myeloid leukemia cells is characterized by persistent mitogen-activated protein kinase (MAPK) signaling. Fragmentary data suggests Src family kinase (SFK) inhibitors enhance differentiation, and thus have potential therapeutic value. The present study shows that SFK inhibitors PP2 and dasatinib enhance aspects of MAPK signaling and regulate a panel of differentiation markers, including CD11b and p47(phox). HL-60 and NB4 myeloid leukemia cells show accelerated ATRA-induced G1/0 arrest/differentiation with inhibitor co-treatment. We also identified components of a Lyn- and c-Raf-containing MAPK signaling complex augmented by the inhibitors. PP2 and dasatinib increased the ATRA-induced expression of Lyn and c-Raf (total and c-RafpS259) and their interaction.

267/3.672). Secondary variables were correlated with DCA axis in a post INCB018424 solubility dmso hoc manner (mean Ellenberg indicator

values (EIV) for moisture (F) and nutrients (N); species richness) References Ammermann K (2008) Energetische Nutzung nachwachsender Rohstoffe. Auswirkungen auf die Biodiversität und Kulturlandschaft. Natur und Landschaft 83:108–110 Bakker JP, Berendse F (1999) Constraints in the restoration of ecological diversity in grassland and heathland communities. Trends Ecol Evol 14:63–68PubMedCrossRef Bauerkämper A (2004) The industrialization of agriculture and its consequences for the natural environment: an inter-German comparative perspective. Hist Soc Res 29:124–149 Benton TG, Vickery JA, Wilson JD (2003) Farmland biodiversity: is habitat heterogeneity the key? Trends Ecol Evol 18:182–188CrossRef Bergmeier E, Nowak B (1988) Rote Liste der Pflanzengesellschaften der Wiesen und Weiden Hessens. Vogel und Umwelt 5:23–33 Bignal EM, McCracken Selleck S3I-201 DI (2000) The nature conservation value of European traditional farming systems. LY3009104 ic50 Environ Rev 8:149–171CrossRef Bischoff A, Warthemann G, Klotz S (2009) Succession of floodplain grasslands following reduction in land use intensity: the importance of environmental conditions, management and dispersal. J Appl Ecol 46:241–249CrossRef Bissels S, Hölzel N, Donath

TW, Otte A (2004) Evaluation of restoration success in alluvial grasslands under contrasting flooding regimes. Biol Conserv 118:641–650CrossRef Boschi C, Baur B (2008) Past pasture management affects the land snail diversity in nutrient-poor calcareous grasslands. Basic Appl Ecol 9:752–761CrossRef Dierschke H, Briemle G (2002) Kulturgrasland. Ulmer, Stuttgart Dierßen K, von Glahn H, Härdtle W, Höper H, Mierwald U, Schrautzer J, Wolf A (1988) Rote Liste der Pflanzengesellschaften Schleswig-Holsteins. SchR Landesamt Natsch LandschPfl, vol 6.

Kiel Donald PF, Green RE, Heath MF (2001) Agricultural intensification and the collapse of Europe’s farmland bird populations. Proc R Soc Lond B 268:25–29CrossRef Ellenberg H, Leuschner C (2010) Vegetation Mitteleuropas mit den Alpen, 6th edn. Ulmer, Digestive enzyme Stuttgart European Commission (2007) Interpretation manual of European Union habitats EUR, vol 27. European Commission, Bruxelles Fischer W (1980) Beitrag zur Gründlandvegetation der Gülper Havelaue. Wissenschaftliche Zeitschrift Pädagogische Hochschule Karl Liebknecht 25:383–396 Gerard M, Kahloun MEl, Mertens W, Verhagen B, Meire P (2008) Impact of flooding on potential and realised grassland species richness. Plant Ecol 194:85–98CrossRef GIVD (2010) Global index of vegetation-plot databases. Reference no. EU-DE-009 BioChange Meadows. http://​www.​givd.​info/​ Grevilliot F, Krebs L, Muller S (1998) Comparative importance and interference of hydrological conditions and soil nutrient gradients in floristic biodiversity in flood meadows.

Interestingly, the rhombus shape suggested that the variable had not been characterized. The OR was far from the midline and differed markedly from other studies. The weight ratio depended on the model used for analysis, with a minimum weight box displayed in the forest plots. The maximal weight box did not represent those reported previously and included the highest number of samples (84,334 cases), Sorafenib mouse although others had difference perspectives (10,808 cases). Although both were prospective cohort studies, subject age was limited from 50 to 79 years,

with no specific age limitations. Association between Peptide 17 chemical structure severe striking life events and the incidence of primary breast cancer Of the 7 included studies, three described severe life events. In one study, life events were categorized into those with little or no threat, some threat, moderate threat, and severe threat, depending on subjective human feelings, with the OR of primary Wnt inhibitor breast cancer higher in subjects with severe threat [17]. A second study evaluated severe life events based on scores, finding that OR of primary breast cancer increased from 5.09 to 5.33 as scores increased [20]. In contrast, when severe life events were based on multiple events, the OR for primary cancer decreased

from 1.12 for a single event to 0.91 for more than three events [23]. To assess the reasons for these differences, we performed a meta-analysis regarding ORs of severe life events in the included studies because the phrase “severe life events” was close to the connotation of “striking life events” in the present study (Table 2). Because the analysis of Ors showed considerable heterogeneity in consistency

tests, the fixed effects model was abandoned and the random effects model was used in our meta-analysis. Table 2 Characteristics and downs & black scores of studies assessing serious striking life events Authors/Year Country Design Valable OR (95% CI) Chen 1995 [17] England from Case–control Severe life events 11.64 (3.10-43.66) Protheroe 1999 [19] Australia Case–control Severe life events 0.91 (0.47-1.81) Kruk 2012 [20] Poland Case–control Major life events 5.33 (4.01-8.21) Helgesson 2003 [21] Sweden Prospective Stressful events 2.1 (1.2-3.7) Lillberg 2003 [22] Finland Prospective Major life events 1.35 (1.09-1.67) Michael2009 [23] America Prospective ≥4 life events 0.91 (0.77-1.08) RR relative risk, CI confidence interval. We found that the risk of breast cancer was strongly and significantly associated with more severe striking life events (OR 2.07, 95% CI 1.06 – 4.03, P = 0.03), suggesting that individuals with severe striking life events would be at two-fold greater risk of developing breast cancer than individuals without these severe striking life events (Figure 2). In addition, we found that the risk of breast cancer incidence was positively associated with both striking (OR 1.51) and severe striking life events (OR 2.

2002). Also, the self-reporting nature of this study may be

affected by the tendency of female physicians to under-rate their own competence (Nomura et al. 2010). This is to our knowledge the first study in Europe of primary care providers’ attitudes to genetic management and how they relate to genetic education. Although the response rate was not high, this is a common problem for postal surveys and all appropriate methods were used to increase the response LY2874455 purchase rates. Databases from which samples were taken varied slightly between countries, but represented the only available national sources with doctors’ addresses and specialties. We recognise that we have studied self-reported rather than actual behaviour but analysis of actual behaviour would have been impossible to be organised practically and self-reporting

can be considered as a reliable proxy measure. Although the scenario used related only to one condition, sudden death from hypertrophic cardiomyopathy was selected as a scenario diagnosis specifically because it was unlikely to have featured in traditional Mendelian genetics teaching. The importance of genetics in its aetiology is, however, well recognised. We therefore suggest that it is likely to be a good model for common complex disorders with genetic aetiology encountered by primary care providers. We have previously demonstrated that genetic care by non-geneticists is patchy and often GSK461364 in vivo poorly documented (Lane et al. 1997; Williamson et al. 1997; Williamson et al. 1996a, b). This is supported by qualitative buy Neratinib research which found highly variable levels of information around referral and testing for Factor V CH5424802 in vitro Leiden (Saukko et al. 2007) and multiple potential barriers to effective communication amongst GPs providing antenatal counselling (Nagle et al. 2008).

Our work shows clearly that, apart from family history taking, many European GPs do not consider that “genetic” care should form part of their practice. Conclusions It is clear that given the significant effect of country of practice, independent of all other factors, on practitioner behaviour, recommendations on genetic education at all levels will have to be sensitive to country-specific issues. Educational structures and content will require tailoring to local priorities and learning conventions. Any standards of care for non-genetic specialists providing some aspects of genetic care will need to be appropriately contextualised into the local system of health care and health education and it is unlikely that a pan-European “one size fits all” policy will be immediately workable or acceptable. Acknowledgements Thanks to Karina Bertmaring, Daniel Cottam and Christine Waterman who provided invaluable administrative and data management support. The study was funded by European Community FP5 grant QLG4-CT-2001-30216. Conflicts of interest None.

01 (Applied Maths, Sint-Martens-Latem, Belgium). The consensus sequences were queried against the pubMLST database to determine the allele designations and Sequence Type (ST) of each

isolate. Sequences of new alleles and new allelic profiles were submitted to the pubMLST database and were assigned new numerical identifiers. As observed by others, amplification and sequencing of gyrB and recA with the selleckchem original primers has not always led to results [17]. Therefore, each of these genes was divided into two fragments (gyrB-up, gyrB-down, recA-up, and recA-down). Two inner primers were designed (gyrB-up_rev: [M13-rev]CGATTCAACCGCTGATTTCACTTC; this website gyrB-down_for: [M13-for]GCGGCACTAACACGTACGCTAAAC; recA-up_rev: [M13-rev]ACGGATTTGGTTGATGAAGATACA; recA-down_for: [M13-rev]GGGTCTCCAAGCTCGTATGC) and ‘5′-tailed’ with the universal M13 primers (M13-for: TGTAAAACGACGGCCAGT PLX3397 and M13-rev: CAGGAAACAGCTATGACC).

This enabled PCR amplification and sequencing with the conditions and in combination with the original primers published by González-Escalona et al.[13]. Peptide sequence type designation Translating the in-frame nucleotide sequences into the peptide sequences allows an analysis on the phenotypic level, as only non-synonymous substitutions of nucleotides leading to a different amino acid were considered. Similar to the nucleotide sequences, each unique peptide sequence was assigned a distinct numerical identifier and the selleck screening library different combinations of alleles at each locus lead to the allelic profile at peptide level. Each individual profile was transformed to a peptide Sequence Type (pST) that allows the unambiguous identification of a clone. The peptide sequences and peptide profiles of the entire pubMLST dataset were submitted to the pubMLST database and implemented as an additional typing scheme, called AA-MLST, accessible at the pubMLST web page [32]. The loci

were labeled with the prefix ‘p_’ and the appropriate locus designation. Data analysis Phylogenetic analysis The generated sequence data were analyzed using Bionumerics and compared to already accessible sequences on the pubMLST web page [32]. To visualize the clonal relationship between isolates of subsets and in context with the entire dataset stored in the pubMLST database the goeBURST algorithm was used [33, 34]. By using the allelic profile data – on nucleotide and peptide level, respectively – isolates were subdivided into groups of related genotypes. Isolates that shared 100% identity in 6 of the 7 loci with at least one other member of the group, the single locus variants (SLVs), were assigned to a single clonal complex (CC). The algorithm also predicted the presumable founder (p)ST of each CC and any single and double locus variants originating. The algorithm was also used to obtain a ‘population snapshot’ with the group definition 0 of 7 loci shared and to create a fullMST, where all STs were connected [34, 35].

Table 1 Reported cases of anorectal avulsion Authors Year Title Management of the anorectal avulsion Mathieson, A. J et al. 1965 Rupture of the posterior urethra and avulsion of the rectum and anus as a complication of fracture of the pelvis Primary repair + presacral HM781-36B drainage + sigmoid loop colostomy Sharma D. et al 2000 Anorectal avulsion:

an unusual rectal injury Primary repair + presacral drainage + sigmoid loop colostomy Terrosu G. et al 2011 Anal avulsion caused Evofosfamide solubility dmso by abdominal crush injury Anal reimplantation + pelvic drainage tubes + loop transverse colostomy Rispoli C. et al. 2012 Anorectal avulsion: Management of a rare rectal trauma Direct suture not possible sigmoid loop colostomy + presacral drainage + anoperineal reparation 10 weeks later R. M. Gomesa et al 2013 Anorectal avulsion: report of a rare case of rectal injury diverting sigmoid loop colostomy (primary repair not possible) Consent Written informed consent was obtained from the patient for publication of this Case report and any accompanying images. Authors’ information School of Medicine And Pharmacy of Fez, Sidi Mohammed OSI-906 in vitro Ben Abdellah University Department of Surgery, University hospital HASSAN II, BP: 1893; Km2.200, Route de Sidi Hrazem; FEZ 30000, MOROCCO. Acknowledgements The authors

would like to thank the patient for his written consent and permission to present this case report. They would also like to thank Miss Ibn Majdoub Hassani Soukaina (Master : Multilingual Specialized Translation, Faculty of Arts and Humanities Sais-Fez /Sidi Mohamed Ben Abdellah University) for her help in editing and correcting

this manuscript. References 1. Cintron JR: Colon and rectum trauma. http://​www.​fascrs.​org/​physicians/​education/​core_​subjects/​2006/​colon_​rectal_​trauma/​ 2. Mathieson AJM, Mann TS: Rupture of the posterior Ibrutinib supplier urethra and avulsion of the rectum and anus as a complication of fracture of the pelvis. Brit J Surg 1965, 52:309.PubMedCrossRef 3. Sharma D, Rahman H, Mandloi KC, Saxena A, Raina VK, Kapoor JP: Anorectal avulsion: an unusual rectal injury. Digestive Surg 2000, 17:193–194. PubMed: 10781991CrossRef 4. Terrosu G, Rossetto A, Kocjancic E, Rossitti P, Bresadola V: Anal avulsion caused by abdominal crush injury. Tech in Coloproctology 2011, 15:465–468. [PubMed: 21556880]CrossRef 5. Rispoli C, Andreuccetti J, Iannone L, et al.: Anorectal avulsion: management of a rare rectal trauma. Int J Surg Case Rep 2012, 3:319–321.PubMedCrossRef 6. Gomesa RM, Kudchadkara J, Araujob E, Gundawarc T: Anorectal avulsion: report of a rare case of rectal injury, letter to the editor. Ann Gastroenterology 2013, 26:1. 7.

e., approximately 20 M), all of the Na+ appeared to be involved in the exchange with Li+ in Na2Nb2O6-H2O. Figure  1a compares the XRD pattern of Li2Nb2O6-H2O and Na2Nb2O6-H2O. The overall XRD pattern of Li2Nb2O6-H2O was quite different from that of Na2Nb2O6-H2O. From an inductive-coupled Selleck Y 27632 plasma (ICP) measurement of Li2Nb2O6-H2O, we did not find any trace of Na+ within the experimental limits. These results imply that crystalline Li2Nb2O6-H2O could be obtained from Na2Nb2O6-H2O through an ion exchange process.

Figure 1 Phase PHA-848125 transformation from Li 2 Nb 2 O 6 -H 2 O to LiNbO 3 . High-resolution X-ray diffraction (HR-XRD) patterns of Li2Nb2O6-H2O at (a) room temperature and (b) elevated temperatures. In (a), we show the XRD patterns of Na2Nb2O6-H2O and LiNbO3 for comparison. (c) Thermogravimetric (TG) and differential scanning calorimetry (DSC) results for Li2Nb2O6-H2O. In Figure  1b, we show in-situ XRD patterns of Li2Nb2O6-H2O at elevated temperatures. The diffraction patterns of Li2Nb2O6-H2O were significantly modified with an increase in temperature, especially above 400°C, and exhibited see more an irreversible phase transformation. In the inset of Figure  1a, we show the XRD pattern after heat treatment of Li2Nb2O6-H2O.

We note that the XRD pattern obtained after heat treatment was well indexed by LiNbO3. To the best of our knowledge, this is the first report for the synthesis of LiNbO3 nanowire through ion exchange and subsequent heat treatment. To gain insight into the phase transformation from Li2Nb2O6-H2O to LiNbO3, we show the thermogravimetric (TG) and differential

scanning calorimetry (DSC) results Dynein in Figure  1c. The mass of Li2Nb2O6-H2O changed significantly near 400°C and was accompanied by endothermic reactions at the same temperature. After the endothermic reactions, an exothermic reaction occurred near 460°C without a noticeable change in the mass. Comparing the well-known phase transformation mechanism from Na2Nb2O6-H2O to NaNbO3[18], the peaks at 400°C and 460°C corresponded well to the dehydration of H2O from Li2Nb2O6-H2O and the structural transformation from Li2Nb2O6 to LiNbO3, respectively. (The broad change in the mass near 220°C seems to have originated from the desorption of surface/lattice-absorbed hydroxyl defects [19]). Due to the light Li ions, we used neutrons rather than X-rays to determine the detailed crystal structure of LiNbO3. Figure  2a shows a Rietveld analysis of the neutron diffraction pattern of LiNbO3. The neutron diffraction pattern of LiNbO3 was well-fit by the trigonal structure (a = 5.488 Å, α = 55.89°) with R3c symmetry. The resulting lattice constant (angle) of the LiNbO3 nanostructure was slightly smaller (larger) than that of the LiNbO3 single crystal (a = 5.492 Å, α = 55.53°) [20]. Based on the Rietveld analysis, we show the crystal structure of LiNbO3 in the inset of Figure  2a.

P-values < 0.05 were considered statistically significant unless stated otherwise. Results Dengue virus serotypes and genetic diversity The sequence data investigated in this study represent genome-wide coding sequences of DENV (n = 260 isolates) from different countries. While samples of DENV serotype 1, 2 and 3 are derived from both Asian and American countries, the collections of serotype 4 are limited to AZD3965 molecular weight Central and South American countries (Additional file 1). The sequences of serotype 4 available

by the GRID project are only from Americas. Thus, serotype 1, 2 and 3 sequences represented geographically more diverse samples unlike the serotype 4 sequences. Accordingly, the genetic diversity observed within serotype 1, 2 or 3 samples was higher than that of serotype 4 samples. The 4-Hydroxytamoxifen purchase average number of nucleotide differences ranges from 168 to 492 among the samples. The nucleotide diversity (π) is ~ 0.04 among samples

belonging to serotype 1, 2 and 3 and 0.01 for serotype 4. The neighbor-joining phylogenetic tree analyses of the coding sequences also show that samples of serotype 1, 2 and 3 are associated with two groups corresponding to Asian and American DENV isolates whereas those of serotype 4 represent a monophyletic group (Figure  1). However, diversity within serotype 4 is also evident that corresponds to the Central and South American DENV isolates, respectively. More than 80% of the nucleotides in the coding sequences of

the DENV genome remain fixed. Although this suggests that these isolates Selleck GSK2118436 are genetically very similar, about 1500 to 2000 sites (15% – 18% of the total sites) reflect nucleotide substitutions among them across serotypes. Furthermore, the relative rate of transition versus transversion substitutions (Additional file 2) also suggests that the nucleotide substitution patterns are biased towards excess transitions over transversions among the samples in each serotype. Figure 1 Geographical structuring within dengue virus serotypes evident from phylogenetic (neighbor-joining tree) analysis. Asian isolates (red) and American isolates (green) are compared for serotypes 1, 2 and 3. For serotype 4, isolates from Central America (light green) are compared with isolates from South America (dark green). Florfenicol The unit of branch length is shown for each tree. Synonymous and non-synonymous substitutions The counts of synonymous and non-synonymous substitution sites are shown in Table  1, and indicate that nearly 80% of all the substitutions in the DENV genome are synonymous. The number of synonymous and non-synonymous changes at 1st, 2nd and 3rd codon positions of each serotype is also shown in Table  1. It shows that the number of silent changes at the 1st position of codons among the samples of serotypes 1, 2 and 3 are similar to that of serotype 4, in spite of differences in the overall nucleotide diversity among the serotypes.

All gels were normalized using a reference

sample with Epoxomicin ic50 bands distributed throughout the whole gel. Analysis of DGGE profile Gel images were aligned using Adobe Photoshop CS5 by running common samples on both outer sides of each gel, to allow comparison of two gels in one profile. DGGE profiles were analysed using Quantity One software (version 4.6; Bio-Rad Laboratories, Hercules, CA). The lanes were identified, and their background intensities were removed using the rolling disk method described in the program. Then bands were detected automatically by the software, followed by manual correction if necessary, and they were matched at 0.5% tolerance level. The tolerance level is the minimum

spacing that the matching model expects to find between unique bands, and it is expressed as a percentage of lane height. The relative quantity of bands is expressed as a proportion (%) relative to the sum of the intensities of all of the bands in the same lane. A similarity matrix was computed by comparing the profiles of lanes, and the percentage similarity was expressed as the Dice coefficient. The presence or absence of a band in a lane was considered. Identical profiles have a percentage similarity of 100. Unweighted BLZ945 pair group method using arithmetic averages (UPGMA) was used to compare the similarity of samples in a dendrogram. The general diversity of AC220 manufacturer bacterial communities was calculated by generating Shannon’s index of diversity on quantitative information [41]. Sequencing of DGGE bands Bands of interest from DGGE gels were excised and immersed in 20 μl of sterile water and left overnight at 4°C. 2 μl of eluted DNA from each band was used as template for PCR re-amplification with the forward primer (without GC clamp) (357f 5′- ATTACCGCGGCTGCTGG -3′) and the reverse primer (518r 5′-CCTACGGGAGGCAGCAG-3′). PCR was performed in a 50 μl reaction mixture including 2 μl of template DNA, 5 μl of 10×PCR buffer, 1 μl of dNTP mixture (2.5 mM each), 1 μl of each primer (10 pM), 0.5 μl of Taq-Polymerase (5 RVX-208 U/μl) and 39.5 μl sterile water. Amplification was performed under the

following conditions: 94°C for 5 min, 20 cycles of 94°C for 30s, 65°C for 30s decreased by 0.5°C for each cycle, and 68°C for 30 s, additional 15 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s, with a final extension at 68°C for 7 min. After the PCR products were purified (QIAquick PCR Purification Kit, QIAGEN) and quantified (Qubit fluorometer, Invitrogen), the sequence analysis of the products was carried out using the Sanger’s method on an ABI 3730 automated sequencing system. The sequences obtained were then aligned with NCBI GenBank databases using the BLAST tool. The phylogenetic tree was constructed using the MEGA 4.0 program in the method of neighbor-joining based on evolutionary distances.