Fukuhara et al.4 have reported significant reductions in all domains of SF-36 scores CT99021 purchase in comparison to population norms for USA, European and Japanese haemodialysis populations, using data from the Dialysis Outcomes and Practice Patterns Study (DOPPS) cohort. Korevaar et al.5 reported reduced scores for all domains of SF-36 and the EuroQOL visual analogue scale for Dutch pre-dialysis patients compared with the general population. Age is strongly related to QOL in patients undergoing dialysis treatment. Most studies show that physical aspects of QOL deteriorate with advancing age as reported by Moreno et al.6 in the Spanish multicentre study

of dialysis patients and by Mingardi7 in the Italian Dialysis-Quality of Life (DIA-QOL) study. However, this has not uniformly resulted in reduction of QOL. Rebollo et al.8 reported less loss of HRQOL in dialysis patients older than 65 years compared with younger patients. This study, the Italian DIA-QOL study and the North Thames study reported by Lamping et al.9 also show that while the physical component scores (PCS) of the SF-36 instrument are lower, the mental component scores

(MCS) are similar to normal population means. Kimmel et al.10 further show that using the satisfaction with life scale, older haemodialysis patients are more satisfied with life in the face of deteriorating physical function. These studies appear to suggest that older people may compensate for deteriorating function by a psychological FK506 adjustment. Poor perceived mental health at the start of dialysis has been shown to be associated with mortality and hospitalization Aurora Kinase as reported by Lopez Revuelta et al.11 This study was conducted in a predominantly diabetic (65.4% of patients) and relatively younger population (mean age: diabetic 61.9 years and non-diabetic 57.0 years) and included haemodialysis and peritoneal dialysis modalities. Kalantar-Zadeh et al.12 showed in a small group of prevalent haemodialysis patients

that a 10-unit decrease in mental health conferred a 2.46 OR of death in 12 months and also increased hospitalization. Merkus et al.13 from the Netherlands Cooperative Study on the Adequacy of Dialysis (NECOSAD) group showed lower PCS and MCS to be associated with a poor outcome in terms of mortality and hospitalization. Lower PCS had 7 times and lower MCS had 5 times greater risk for poor outcome. Mapes et al.14 showed a similar effect from the DOPPS data in their prevalent haemodialysis population. The response rate in this study for completing the KDQOL-SF was 58.2%, with non-responders having had much shorter time on dialysis and higher comorbidity characteristics. Racial and cultural factors are likely to impact on QOL. Unruh et al.15 showed that African-American patients on haemodialysis report significantly better psychological well-being and lower burden of disease than non-African-Americans. Mapes et al.

Moreover, their guiding of rare tumour-specific CD8+ T cells to sites of DC–CD4+ T cell interactions by secretion of CCL3 and CCL4 is needed. We therefore analysed the chemokine mTOR inhibitor profile and the lymphocyte-attracting ability in vitro of monocyte-derived PGE2DCs and αDC1s from patients with CLL. αDC1s produced much higher levels of CXCR3 ligands (CXCL9/CXCL10/CXCL11) than PGE2DCs. Functional

studies further demonstrated that αDC1s were superior recruiters of both NK and NKT cells. Moreover, αDC1s produced higher levels of CCL3/CCL4 upon CD40 ligation. These findings suggest that functional αDC1s, derived from patients with CLL, produce a desirable NK-, NKT- and CD8+ T cell-attracting chemokine profile which may favour a guided and Th1-deviated priming of CD8+ T cells, supporting the idea that αDC1-based vaccines have Erlotinib manufacturer a higher immunotherapeutic potential than PGE2DCs. Chronic lymphocytic leukaemia (CLL) has traditionally been considered an incurable disease [1], which seems to hold true even in the era of

immunochemotherapy. Yet, complete molecular remissions and long-term disease-free survival are seen after allogeneic stem cell transplantation (alloSCT), providing evidence of a graft-versus-leukaemia effect and thus suggesting the possibility of an immune-mediated cure for CLL [2, 3]. However, procedure risks (i.e. non-relapse mortality and severe chronic graft-versus-host disease), patient age and, in many cases, patient co-morbidity makes alloSCT a possible treatment option only for a minority

of patients with CLL. Still, the strong antitumour response seen after alloSCT implies that CLL could be an attractive target for other less toxic immunotherapeutic strategies. Dendritic cells (DCs) have a unique ability to efficiently present antigens to naïve T cells and are key players in the initiation and regulation of innate and adoptive immune responses [4]. There are several preclinical studies regarding ex vivo-generated DCs as potential vaccines against CLL [5–10] because this could be a strategy to circumvent the immune defects [11] and the reported dipyridamole dysfunction of DCs in patients with CLL [12]. However, to enable T helper 1 (Th1) and cytotoxic T cell (CTL) induction and antitumour responses in vivo, a DC has to present relevant tumour antigens in combination with costimulatory molecules [13]. Of major importance is also the production of IL-12p70, known to polarize the immune response towards a Th1 response which is crucial for the induction of tumour-specific CTLs [14, 15]. However, the ability of injected vaccine DC to induce a Th1-polarized immune response in vivo most likely relies on additional features. Of potential importance is a chemokine secretion pattern, recently shown to be imprinted during DC maturation [16, 17], that should favour the recruitment of NK and probably also NKT cells into the vaccine-draining lymph node while avoiding interaction with regulatory T cells [18, 19].

Myc-tagged viral Pellino and Pellino3S were cloned into the vector pRSET A-His, expressed in Escherichia coli (BL21 cells) and purified using the His-bind purification kit (Qiagen). For the in vitro ubiquitination assay, recombinant Pellino protein (1 μg) was incubated with ubiquitin (1 μg), E1 (50 ng), UbcH13/Uev1a (400 ng) and protease inhibitor mix (EDTA free) in 5 mM Tris-HCl, pH 7.5, containing MgCl2 (2 mM), ATP (2 mM) and NaCl (100 mM). Reactions were incubated at 37°C for 2 h and terminated by addition of SDS-PAGE sample buffer. Samples were then resolved by SDS-PAGE and analysed by immunoblotting using an anti-ubiquitin antibody

(Santa Cruz). Drosophila Schneider Selleck PD0325901 2 (S2) cells were cultured in Schneider’s Insect Medium supplemented with 10% v/v fetal bovine serum, penicillin G (100 μg/mL) and streptomycin (100 μg/mL). Cells were maintained at 25°C without CO2 buffering. C-106 stimulation was performed on cells in serum-containing medium at 25°C. HEK293T cells and HEK 293-TLR4 cells (gift from Douglas Golenbock) and U373 cells were cultured in DMEM supplemented with 10% v/v fetal bovine serum, penicillin G (100 μg/mL) and streptomycin (100 μg/mL). G418 (0.5 mg/mL) was used as a selective agent for the stably transfected 293-TLR4 cells.

LPS Selleck Ibrutinib stimulation was performed on cells in serum-containing medium at 37°C. Cells were seeded at 1.8×105 and 2×105/mL, respectively, in 96-well plates (200 μL/well) and 6-well plates (3 mL/well) and grown for 24 h to approximately 80% confluency. Cells were transfected using Lipofectamine (Invitrogen), with each well in a 6-well

and 96-well plate being transfected with 4 μg and 230 ng total Decitabine DNA, respectively. For 96-well plate transfections, lysates were generated using Reporter Lysis Buffer (Sigma). Firefly activity and Renilla luciferase activities were assayed using luciferase substrate (Promega) and coelenterazine (0.1 μg/mL in PBS), respectively. Cells were seeded at 2×106/mL in 12-well plates and grown for 24 h. Transfection was then performed using the Calcium Phosphate Transfection kit (Invitrogen) according to the manufacturer’s instructions. For each well, a total of 1 μg DNA was used. In total, 24 h post-transfection cells were washed twice in serum-free Schneider’s Medium, re-seeded in fresh medium and stimulated overnight with or without C-106 ligand. Lysates were generated with Reporter Lysis Buffer (Promega) and assayed for firefly luciferase activity. β-Galactosidase activity was assayed by incubating cell lysate with o-nitrophenyl-β-galactoside (1 mg/mL) at 37°C for 15 min before reading absorbance at 420 nm. Briefly, 24 h post-transfection, cells were lysed in 50 mM Tris-HCl (pH 7.5) containing 150 mM NaCl, 0.5% v/v Igepal, 50 mM NaF, 1 mM Na3VO4, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, protease inhibitor mixture (25 μg/mL leupeptin, 25 μg/mL aprotinin, 1 mM benzamidine and 10 μg/mL trypsin inhibitor).

Adriamycin nephropathy (AN) mice, the model of focal segmental glomerulosclerosis mice, daily injections 0.5 mg/kg body weight of rapamycin. Physiological changes, ER stress and nephrin were observed at 1, 3, 5 weeks. Results: ER stress (GRP78, GADD153), cell death (PI stain), and autophagosome formation (LC3II) were increased after TG or TM treatment in podocyte. Inducing autophagy by rapamycin reduced ER stress-inducing cell death in the early phase (6 hr). Inhibit autophagy by 3-MA was accelerated cell death. In AN mice, ER stress was increased and accompanied by the loss of nephrin and albuminuria. Daily rapamycin injection reduced of ER stress and nephrin loss at 3th week.

At 5th week, the reduction seems to be delayed. Conclusion: Induced ER stress might be related with podocyte cell death. Autophagy would be simultaneously buy Cilomilast enhanced, and it mediated to salvage the injuries

caused by ER stress in short term. Rapamycin increased the autophagosome formation and exhibited a similar influence on podocyte as the ER stress-related autophagy. We proposed that adequate, but not excessive, autophagy is crucial to help maintain the cell viability and structure of podocyte as a terminally differentiated cell lineage in glomerulus. OGAWA AYU1, SUGIYAMA HITOSHI1,2, Pexidartinib cell line KITAGAWA MASASHI1, YAMANARI TOSHIO1,2, ONISHI AKIFUMI1, MORINAGA HIROSHI1, KIKUMOTO YOKO1, KITAMURA SHINJI1, MAESHIMA YOHEI1,3, MAKINO HIROFUMI1 1Department of Medicine and Clinical Science, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences; 2Department of Chronic Kidney Disease and Peritoneal Dialysis, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical

Sciences; 3Department of CKD and CVD, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences Introduction: Autophagy is a cellular process involved in the bulk degradation of proteins and organelle turnover. Recent studies have demonstrated the significance of autophagy of the tubular epithelium in several renal tubulointerstitial disorders using mouse models. However, the role of autophagy in the regulation of human glomerular Fludarabine diseases remains unclear. This study aimed to elucidate the morphological evidence for autophagy and its association with ultrastructural alterations of podocytes and clinical parameters in patients with minimal change nephrotic syndrome (MCNS). Methods: The total study population included 116 patients with glomerular diseases (MCNS: 34, membranous nephropathy, MN: 27, IgA nephropathy, IgAN: 21, lupus nephritis, LN: 10 and others: 24) who underwent renal biopsies. The study investigated the number of autophagic vacuoles and the degree of foot process effacement (FPE) in podocytes using electron microscopy.

1A). Sequence identity of genes and promoters was verified by sequencing.

Pre-BI cells were propagated on preseeded OP9 stromal feeder layer cells irradiated with 20 Gy in serum-free (SF) IMDM medium (Invitrogen, Carlsbad CA, USA) containing primatone (0.03%, Kerry Bio-Science, AH Almere, Netherlands), 5 μg/mL insulin (Sigma-Aldrich, St. Louis, MO, USA), 1× MEM selleck kinase inhibitor non-essential amino acids (Invitrogen), 2% FCS (Sigma) and 1% IL-7-containing supernatant (∼5 ng/mL; 39). Cells were split every 3–4 days and replated on irradiated 70–80% confluent OP9 feeder layers. Retroviral vectors were transiently transfected into the packaging cell line Plat-E 40 using Lipofectamine (Invitrogen) as suggested by the manufacturer. About 1 mL of retroviral supernatant was used to transduce 2×105 pre-BI cells for 3 h at 30°C at 1157×g in 2 mL tubes in the presence of IL-7. One day after transduction, successfully transduced cells were selected

with the appropriate antibiotic. Transduction rates of 10–40% were achieved. Different retroviral vectors were transduced sequentially, after selection of the cells transduced with the preceding vector. About 5×106 pre-BI cells were lysed in Ripa buffer (Sigma-Aldrich). About 30 μg protein were separated on a 11% denaturing polyacrylamide gel and blotted onto a PVDF membrane. The membranes were probed with either mouse anti-Myc (clone 9e10, Santa Cruz Biotech, Santa Cruz, CA, USA) or with a monoclonal anti-beta-actin antibody (clone AC-15, Sigma-Aldrich). RNA was prepared from 5×106 pre-BI cells using Trizol AP24534 concentration reagent Thymidine kinase (Invitrogen). For cDNA preparation, equal amounts of RNA and dilutions thereof were used for each condition. cDNA generation was performed using SuperscriptIII reverse transcriptase (Invitrogen) and pT18 primers (Fermentas). Amplification of cDNA products was made using

the primers ctggagtcgcagtaccagg and cagttctccccaatcggaaatc for detection of Pim1, atgcccctcaacgttagcttc and cgcaacataggatggagagca for Myc, and catgttccagtatgactccactc and gtagactccacgacatactcagc for Gapdh. After cultivation for 2 days on OP9 feeders in the absence of IL-7+/− doxycycline hyclate (Invitrogen), 1×106 pre-B cells were fixed in 70% ice-cold ethanol at −20°C. Cells were then stained for 30 min at 37°C with 25 μg/mL propidium iodide (PI, Invitrogen), 0.05% Tween20 (Carl Roth GmbH, Germany) and 25 μg/mL RNAse A (Qiagen GmbH, Germany) in PBS and subsequently analyzed by FACS. PI was recorded in linear mode; cells in S/G2/M phases were gated manually. All experiments were performed with 6–12-week-old mice that were maintained in the specific pathogen-free animal facility at the Max-Planck Institute for Infection Biology. C57BL/6 Rag1−/− mice were irradiated 1 day before transplantation with 4 Gy.

[7-9] However, for IgA nephropathy patients with significant risk for rapid disease progression,[12, 13] it is still unclear whether the addition of anti-oxidant therapy increases the therapeutic efficacy. In the present study, to examine of the clinical benefits and safety of

probucol (an anti-oxidant and anti-hyperlipidemic agent) in combination with valsartan (an ARB) in patients with IgA nephropathy, we conducted a multi-centre, open labelled, randomized controlled study. This multi-centre, Selleckchem Epigenetics Compound Library randomized, open-label, controlled and parallel clinical trial enrolled patients with biopsy-proven IgA nephropathy from January 2007 to January 2010. The inclusion criteria were: age of 18–75 years; 24-h urinary protein of 1.0–3.0 g; serum creatinine no more than 265.2 μmol/L; no treatment with an angiotensin converting enzyme inhibitor (ACEI), ARB, anti-oxidant, lipid-lowering drug in Autophagy Compound Library cell line the previous 6 weeks, and no treatment with steroid or cytotoxic drug within the previous 6 months. Patients with any of the following were excluded: secondary IgA nephropathy (Henoch-schonlein purpura nephritis, hepatitis

B virus associated glomerulonephritis, cirrhosis, lupus nephritis, connective tissue diseases), malignant hypertension, acute kidney injury, crescentic glomerulonephritis, diabetes, renal artery stenosis, obstructive nephropathy, pregnancy, tumour, active gastrointestinal ulcer, coronary heart disease, cardiomyopathy, serious arrhythmia, cerebrovascular disease, and active infection (including tuberculosis). Patients who did not comply with the Cobimetinib in vitro treatment were also excluded. A computer-generated list that was maintained by a third party not involved in the conduct of the study was used for randomization. Investigators were unaware of the randomization schedule when recruiting patients, and both investigators and patients were not blinded during the follow-up period. Two pathologists who were blinded to this study independently made all of the pathological examinations. At the end of study, the pathologists used the Oxford classification system

of IgA nephropathy to evaluate renal tissue sections. The study protocol was approved by the institutional review boards at each site, and all patients gave written, informed consent. All study procedures were performed in accordance with the principles of the Declaration of Helsinki. The flow chart of the study was shown in Figure 1. All 75 eligible patients were screened before formal enrolment. For screening, patients were treated with 80 mg/day valsartan for 4 consecutive weeks, during which blood pressure, serum potassium, serum creatinine, and cough were monitored. After 4 weeks, patients who had serum potassium less than 5.5 mmol/L, an increase in serum creatinine less than 30%, and without intolerable side-effects related to valsartan therapy were given 160 mg/day valsartan for 4 weeks.

As shown in Fig. 2A, the administration of CT caused notable changes in the expression of MHC-II and CD86 in LCs compared

with PBS administration, and these effects were primarily observed in the cell bodies. DC activation was also observed following local administration of a mixture of agonistic anti-CD40 and poly(I:C). Other surface markers such as CD40 were also expressed after local administration of CT but not with HEL or PBS (Supporting Information Fig. 3). Next, we assessed the consequences of local CTB inoculation compared with those of CT. As shown in Supporting Information Fig. 4A and B, CT induced a stronger degree of inflammation at the site of inoculation than CTB, which did not induce any overt inflammation. However, Ceritinib ic50 Sunitinib datasheet both CT and CTB induced expression of CD86 in LCs. To determine whether local administration of CT or CTB could induce the mobilization of LCs, the presence of MHC-II+ Langerin+ cells in epidermal sheets was evaluated. As shown in Fig. 2B, there was no difference 90 min after inoculation; however, by 24 h after inoculation with both CT and CTB, the number of LCs was significantly reduced. We next examined whether the inoculation of CT or CTB affected the production of cytokines by epidermal

and dermal cells. As Fig. 2C shows, inoculation with either CT or CTB induced a significant increase in the levels of TGF-β below in dermal cells. Interestingly, the cells that

expressed high levels of TGF-β after CT or CTB inoculation were Langerin+ DCs in the dermis (Fig. 2D). The inoculation of CT or CTB reduced the expression of IL-6 and MCP-1 in dermal cells but did not affect the production of IL-10 or TNF-α (Supporting Information Fig. 5). These results indicate that CT and the CTB subunit induce important changes in the phenotype of ear DCs. Considering both the robust CD4+ T-cell proliferation and the changes observed in DCs that were induced by the inoculation of CT in the ear, we next evaluated the cytokine profile of HEL-specific CD4+ T cells 3 days after immunization with HEL plus CT or CTB. A significantly increased levels of IFN-γ and (to a lesser extent) IL-2, TNF-α and IL-17 were observed in HEL-re-stimulated T cells isolated from mice that were immunized in the ear with only 0.3 μg HEL in combination with 1 μg CT or CTB (Table 1). We could not detect production of either IL-4 or IL-5. Practically none of the evaluated cytokines were detected in HEL-re-stimulated T cells isolated from mice that had received HEL alone or PBS or in T cells that were not re-stimulated in vitro with HEL. For comparison, we immunized mice in the ear with 0.3 μg HEL in combination with a mixture of anti-CD40/poly(I:C), and the resulting production of all of the evaluated cytokines was similar to that following co-administration of HEL and CT (Table 1).

DC at the tumor site as well as the draining lymph nodes become increasingly suppressed and contribute to T-cell anergy/deletion or to T-cell suppression via

Treg. Cancer vaccines must induce high-quality effector T cells, which as CTL or Th cells can eliminate tumor cells (including tumor-initiating cells) and/or produce advantageous cytokines. It is, however, also important to generate long-lived tumor-specific memory T cells in order to maintain anti-tumor responses as well as to prevent relapse, or as in the case of prophylactic vaccines, avoid disease. DC control Selleck Staurosporine T cells and guide their differentiation 11. The DC system is astonishingly complex and composed of different subsets with considerable plasticity 12. It is important to note that tolerance induction is the major function of DC in the steady state as also outlined in the accompanying article by Maria Rescigno 13. Only presentation of antigen by sufficiently matured DC expressing costimulatory molecules (such as membrane-bound CD86 and CD70 and/or soluble IL-12) will result in robust T-cell proliferation and differentiation, and thus effective

T-cell immunity. DC maturation is therefore a complex program; depending on both the DC subset and the type of maturation stimulus, variable acetylcholine set of genes and pathways are activated, leading to diverse differentiation Selleck Tamoxifen programs in the stimulated T cells. DC are, therefore, key to successful vaccination 14, 15. An optimal vaccine requires both antigen-targeting to DC and adequate DC maturation by adjuvants to induce a maturation program that is suitable for T-cell immunity. These crucial aspects of DC biology have until recently

been largely underestimated, while the choice/format of antigen and vaccination schedule were prioritized. In vivo DC targeting” is considered by many as the vaccine strategy of the future and will be tested in clinical trials in the coming years. In mouse models, injection of anti-DC (e.g. anti C-type lectin) antibodies fused to antigens induces tolerance by several mechanisms, but vigorous immunity can also be induced if a suitable maturation stimulus is co-delivered 16, 17. Our knowledge on the type of stimulus required in such a setting for optimal immunogenicity is expanding 18. Differential expression of receptors might allow targeting of select DC subsets and “tailor-made” immunization 19, 20. Effective immunization was also observed following delivery of TLR ligand–antigen conjugates, which contain the maturation stimulus but are not as precise in cell targeting 21.

2 (Thy1.2)-coated microbeads (Miltenyi Biotec, Germany). T cells from Thy1.1 mice were isolated with the Pan T Cell Isolation Kit (Miltenyi Biotec). In experiments involving the transfer of Thy1.1 T cells, all donor T cells were isolated with the Pan T Cell Isolation Kit. For adoptive transfer experiments, 1–3×107 T cells were i.v. transferred into recipient mice. In brief, 5×107 cells were incubated in 1 mL of 10 μM 5(6)-carboxyfluorescein diacetate N-succinimidyl ester (CFSE, Sigma) in PBS, 0.1% FCS for 10 min at 37°C. Labeling of cells was stopped by adding five volumes of ice-cold IMDM 10% FCS and washing three times with IMDM 10% FCS. Briefly, 2–3×107 Thy1.2-sorted splenocytes

from P14 TCRtg, P14×LMP7−/− TCRtg or P14×MECL-1−/− TCRtg mice were CFSE labeled and transferred i.v. into either naïve Thy1.1 mice or Thy1.1 mice that had been infected with 2×104 PFU LCMV-WE 24 h earlier. In total, 16 and 40 h after transfer, splenocytes were Navitoclax order analyzed with a FACSCalibur™ flow cytometer after RBC-lysis with 1.66% NH4Cl w/v and staining for CD8+ cells (APC rat anti-mouse CD8a, clone 53–6.7, BD Pharmingen). To determine the percentage of transferred cells currently undergoing apoptosis versus T cells that are already dead, the splenocytes have been stained

with PerCP rat anti-mouse CD8a (clone 53–6.7, BD Pharmingen), Annexin-V-Pacific Blue (Molecular Probes) and To-Pro-3 (Molecular Probes) after RBC-lysis. In this case, acquisition was done with the LSRII™ flow cytometer (BD Biosciences). To statistically assess Everolimus manufacturer differences between groups, Student’s

unpaired t-test was performed using the GraphPad software. A p-value<0.05 was considered statistically significant for all analyses. The authors thank Ulrike Beck for excellent technical assistance. John Monaco and Oliver Planz are acknowledged for contributing gene targeted and transgenic mice; Dirk Busch is acknowledged for contributing recombinant Listeria. This work was supported by grants from the German Research Foundation (DFG) No. GR1517/4-1/2 and GR1517/5-1/2. Conflict of interest: The authors declare no financial or commercial conflict of interest. ROS1 Detailed facts of importance to specialist readers are published as ”Supporting Information”. Such documents are peer-reviewed, but not copy-edited or typeset. They are made available as submitted by the authors. “
“Interacting pathogens and hosts have evolved reciprocal adaptations whose function is to allow host exploitation (from the pathogen stand point) or minimize the cost of infection (from the host stand point). Once infected, two strategies are offered to the host: parasite clearing (resistance) and withstanding the infection while paying a low fitness cost (tolerance). In both cases, the immune system plays a central role. Interestingly, whatever the defence strategy adopted by the host, this is likely to have an effect on parasite evolution.

A one-way analysis of variance (anova) was used to compare the levels of cytokines, IgE and EPO between groups. Fisher’s exact test was used to compare proportions. The alpha level for statistical significance was established as 5%. The severity of the inflammatory response to OVA was evaluated in the lungs of mice immunized with S. mansoni antigens and in control

mice. A dense mixed-cellular PD98059 molecular weight infiltrate surrounding the airway was observed in the sensitized non-immunized mince (Fig. 2b) and in the IPSE-immunized group (Fig. 2f). Comparatively, much less peribronchial airway inflammation was observed in OVA-sensitized mice immunized with Sm22·6, PIII and Sm29, and in non-sensitized mice that were treated with PBS (Fig. 2c,d,e,a, respectively).

Mice immunized with the S. mansoni antigens Sm22·6, PIII and Sm29- had significantly fewer total cells and eosinophils in the BAL fluid than did non-immunized mice and mice immunized with IPSE, while there was no significant difference in the number of neutrophils, lymphocytes and macrophages between groups (Table 1). The serum levels of OVA-specific IgE were Compound Library screening measured in sensitized non-immunized mice and in those immunized with the different S. mansoni antigens. The levels of this isotype were markedly lower in S. mansoni antigen-immunized mice than in sensitized non-immunized mice (Fig. 3a). The levels of eosinophil peroxidase (EPO) were also significantly lower in the lungs of mice immunized with Sm22·6 and PIII than in the non-immunized group (Fig. 3b). We measured the cytokines IL-4, IL-5 and IL-10 Adenosine triphosphate in BAL fluid. The levels of IL-4 and IL-5 were lower in mice immunized with Sm22·6 and PIII compared to non-immunized mice (Fig. 4a,b, respectively). The

levels of IL-10 were higher in BAL of Sm22·6 immunized mice than in non-immunized mice (Fig. 4c). In order to evaluate the imbalance of the regulatory and the Th2 profile of cytokine, we performed the ratio between the levels of IL-10 and IL-4 in BAL. We observed that in mice immunized with Sm22·6 and with PIII the ratio IL-10/IL-4 was higher than in non-immunized mice (Fig. 4e). Along with the Th2 and regulatory cytokines, we also measured IFN-γ and TNF-α in BAL fluid. The levels of IFN-γ were lower in mice immunized with Sm29 (40 ± 10 pg/ml) when compared to the non-immunized mice (120 ± 40 pg/ml), while in the other groups the levels of this cytokine did not differ significantly from what was observed in non-immunized mice (Fig. 4d). The levels of TNF-α were below 50 pg/ml in all groups of mice. The frequency of CD4+FoxP3+ T cells and of CD4+FoxP3+IL-10+ T cells in cultures stimulated with OVA was evaluated in the different groups of mice. We found that the frequency of the CD4+FoxP3+ T cells was significantly higher in mice immunized with Sm22·6 and PIII. There was a tendency of higher expression of these cells in mice immunized with Sm29 (P = 0·06) (Fig. 5a).